Typing of 67 SNP Loci on X Chromosome by PCR and MALDI-TOF MS

Research in Genetics

Download PDF  | Download for mobile

Li Li, Yan Liu and Yuan Lin

Shanghai Key Laboratory of Forensic Medicine, Institute of Forensic Science, Ministry of Justice, China, Shanghai, China

Volume 2015 (2015), Article ID 374688, Research in Genetics, 9 pages, DOI: 10.5171/2015.374688

Received date : 23 June 2014; Accepted date : 14 August 2014; Published date : 13 March 2015

Academic editor: Jian Tie

Cite this Article as: Li Li, Yan Liu and Yuan Lin (2015), "Typing of 67 SNP Loci on X Chromosome by PCR and MALDI-TOF MS," Research in Genetics, Vol. 2015 (2015), Article ID 374688, DOI: 10.5171/2015.374688

Copyright © 2015. Li Li, Yan Liu and Yuan Lin. Distributed under Creative Commons CC-BY 4.0

Abstract

A set of single nucleotide polymorphisms (SNP) on X chromosome was selected with the aim of forensic identification in Chinese Han population to complement the analysis of autosomal, Y-chromosomal or mitochondrial markers, especially in deficiency cases. 67 forensically relevant X-SNPs were screened in a Chinese Han population sample. Genomic DNA samples extracted from 295 unrelated Chinese Han individuals were typed using three 17-plex and one 16-plex amplification reactions in combination with genetic analysis assisted by mass-spectrometry based on MassARRAY MALDI-TOF MS platform (Sequenom Inc.). All the investigated loci except rs12849634 were found to be in Hardy-Weinberg equilibrium. A total of 52 of the loci showing independent inheritance and high polymorphisms with minor allele frequency (MAF) above 0.3 were finally screened out. The accumulative exclusion probabilities (CPE) in trio cases and duo cases were above 0.999999. The combined discrimination power (CDP) in female population and male populations were above 0.999999999999999. It is concluded that the panel of informative SNP markers on X chromosome may be used for forensic genetic purposes. The mass spectrometry-based method for X-SNPs profiling was suitable for high-throughput application and could have promising prospects.

Keywords: Forensic genetics; SNP; X chromosome; MALID-TOF Mass

Introduction

Single nucleotide polymorphisms (SNP) typing on X chromosome could effectively complement the analysis of autosomal, Y-chromosomal or mitochondrial markers very efficiently. The markers may be easily amplified in samples with low-quality and degraded DNA.

In some deficiency kinship cases, e.g. relationship between paternal grandmother and granddaughter or relationship between half-sibling sisters who have the same father, X-chromosome markers are valuable and necessary, as reviewed by Pereira et al (2011). Additionally, for solving special father-daughter duos or mother-daughter-father trios, in which only 1~2 loci (out of 19~39) autosomal STR(Short Tandem Repeat)loci were exclusionary, X-SNP loci with genetic stability may be used as supplementary markers to autosomal STR loci to further confirm or exclude paternity or maternity. 

Therefore, we planned this study. 67 SNPs on X chromosome were amplified in four multiplex PCR systems followed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS, mentioned by Storm N et al 2003 and Tost et al 2005)  in Chinese Han population samples. Hardy-Weinberg equilibrium was analyzed and forensic genetic parameters were calculated.

Materials and Methods

Sample

295 blood samples were collected from unrelated Chinese Han individuals (215 males and 80 females) under informed consent. DNA was extracted from whole blood by using BLOOD DNA EXTRACTION kit according to manufacturer’s instructions (Sangon Biotech, Shanghai, China).

Primer Design

67 SNP markers (Table 1) on X chromosome with high minimal allele frequency (MAF>0.4) were selected from HapMap (www.hapmap.org) and NCBI SNP database (http://www.ncbi.nlm.nih.gov/SNP). The locus to locus space was about 3~20Mb. 67 groups of primers were designed via MassARRAY Assay Design software (Sequenom Inc.). Each group has three primes, including a pair of PCR primes and a single base extension prime (Table 2). Primers were synthesized by Sangon Biotech (Shanghai, China).

Table 1: Primers for Amplification and Extension Reactions of 67 X-SNPs

SNP_ID

Forward primer(5’→3’) for PCR

 

Reverse primer (5’→3’) for PCR

 

Amplicons (bp)

Primer for extension reactions

molecular weight(D)

Reaction â… (17-plex)

rs203648

ACGTTGGATGTAGCTCCTCTGAGTCTTGTC

 

ACGTTGGATGTGAAAAGCATGCCCTCTGCG

 

95

CCACAGGCCCCCACAGC

5070.3

rs1166756

ACGTTGGATGGCTCAGGCAAGCACATGTTT

 

ACGTTGGATGGTTCTAGAGGGCAACATAGC

 

101

GTCATCGTCAATGCAGG

5210.4

rs611711

ACGTTGGATGGTTTTCTAGGAAAGAACAAG

 

ACGTTGGATGCCTCATCCTGAAAACATCGC

 

100

AAGAACAAGAGAACCAGT

5558.7

rs7876774

ACGTTGGATGAGAGGAGTCTGTCTGATCTG

 

ACGTTGGATGAGGTCATCAGGAAAGTCATC

 

98

ATGGGACGAGTGTGTCTA

5594.6

rs1544545

ACGTTGGATGTTATCCCCATTCAGACACAC

 

ACGTTGGATGGACTCTGTTAGGGTTGATTG

 

102

CCAAGTCTCCCACTATTTA

5682.7

rs5905043

ACGTTGGATGTTGAGCCTGGGATGTTAGAC

 

ACGTTGGATGTACTCAGCATACTTCTCCCC

 

96

TTCCCATTGAGAGAAACCT

5771.8

rs1229078

ACGTTGGATGCAAACCTGTAACACATGACC

 

ACGTTGGATGGTAAGATTGTTTAAATTTAGG

 

97

TGACCAAAGTAACCATTGAG

6134

rs5932595

ACGTTGGATGAAGCTTGCTTCTGCCCATTC

 

ACGTTGGATGTTTGCTGAGCATTATGGCCC

 

100

ATGATGGAACAGAAATCAGA

6207.1

rs17264553

ACGTTGGATGTCAAAGACAGCCAGTAAGCC

 

ACGTTGGATGTTGAGAATTGCAGCCATCAG

 

95

CAGCCAGTAAGCCTACCCAAC

6329.1

rs2070289

ACGTTGGATGATCCTCACGATGGCAGTAGT

 

ACGTTGGATGATACAGGAAGGGCGGGAGTA

 

98

GTAGTGCTCCAAATATGCTAAG

6758.4

rs1874111

ACGTTGGATGCCTTTCAGATTACTGAGTAG

 

ACGTTGGATGTGCTCCAGATAAGCCACTTG

 

100

GTACAAGAAATTAAGAGTGGAA

6864.5

rs5968332

ACGTTGGATGCCACCCACACATTATTAATGC

 

ACGTTGGATGGAGGCAGGTTTCCGATTTTG

 

100

CCACACATTATTAATGCTTATCA

6941.6

rs5931302

ACGTTGGATGTGCACATTCCAGGCAAGGTC

 

ACGTTGGATGAATAGGGACGGAAAAGTTGC

 

94

TCCAGGCAAGGTCCATGCTAAAAA

7354.8

rs4442270

ACGTTGGATGAAAGAAATGACCCAGTGGAG

 

ACGTTGGATGGTCTGTCATTTCGATTCAGG

 

82

AATGACCCAGTGGAGAATTATGAC

7409.8

rs5923750

ACGTTGGATGGGAAGAGAGAATTTGGGAAG

 

ACGTTGGATGTCTTTCAGGATTCAAAAGGC

 

99

TTTACTCTGCCATTTTCACTGACAT

7532.9

rs5917032

ACGTTGGATGTCACCACTGTGCTATCCTTC

 

ACGTTGGATGCCTCCATTAGGGCTTTTCCA

 

99

TAATGCATAACTGCAATCTAATCATG

7937.2

rs6639398

ACGTTGGATGGCTTATACCAGTCTCATTGC

 

ACGTTGGATGAATGTATCAGGACAGAGAGAC

 

84

ggaTCATTGCACTAATTGAAATATTG

8008.2

Reaction â…¡ (16-plex)

rs2209420

ACGTTGGATGCTCATTCATGTGGGAGCTTT

 

ACGTTGGATGACCCTTCCCAGCCTCTTGTA

 

99

TGATCTCGTGGAGGCAA

5250.4

rs5986750

ACGTTGGATGAGGATTTGCAGGCCCAATAG

 

ACGTTGGATGGAACTCTTCAGGAGCGTATC

 

97

AGACACTCCACAGGTGTA

5492.6

rs5989571

ACGTTGGATGGTACAGGATGTGGGAAAGTG

 

ACGTTGGATGGAGAACTGATGCTCCACATA

 

105

TGTGGGAAAGTGCGTATG

5634.7

rs7471388

ACGTTGGATGGTGTGTCTGCTTTTGCCTTC

 

ACGTTGGATGTCCTGTGGATTCTGAATGTG

 

89

TCATTACTGACTGAAGACC

5771.8

rs149860

ACGTTGGATGCCAGTGCCCTATTCTGCAGT

 

ACGTTGGATGAAAGGAGATGTAAGAGTGGG

 

97

CCTATTCTGCAGTGACTGAG

6108

rs5954988

ACGTTGGATGTTTCAAACCTTGCCCCCATC

 

ACGTTGGATGGGCAACAATAGACACTGATG

 

82

CCCATCCATTCTTTCCCACTC

6188

rs471205

ACGTTGGATGCTTCCACGAAGGACAAACTG

 

ACGTTGGATGGACTTGGTCTCAGACATCAG

 

100

TCCCTCTGCTGTTATAGCCTT

6314.1

rs2214174

ACGTTGGATGTAAATCCTCTGTGTTTTCC

 

ACGTTGGATGTCATGTCTGAAAGCTGTTGC

 

99

CTCTGTGTTTTCCAATGAAAAT

6699.4

rs2768595

ACGTTGGATGGAGGGATTGAATCTCTAGTC

 

ACGTTGGATGTGGTCTATATCCATCAAGTC

 

96

TTGAATCTCTAGTCTAAGATGA

6748.4

rs6639989

ACGTTGGATGGTTATGAGGCTTTGAAAAGG

 

ACGTTGGATGAGGACATCGATGATAATCTG

 

98

TGAGGCTTTGAAAAGGAAATCG

6847.5

rs6418251

ACGTTGGATGAGCTGGAAAATCATTTGGAG

 

ACGTTGGATGGAATGTTACAGTGAAAGAGC

 

88

TGGAGATTTACAGAGGGGATTAG

7207.7

rs9781645

ACGTTGGATGGTAAGGCTGAGCTTTAGAGG

 

ACGTTGGATGGAAAGTTTGTCCTTCATCAG

 

93

GGGCCACAGTCCATTCCAATAGCA

7306.8

rs2694717

ACGTTGGATGTGACTAACGAGTGCCTTAGC

 

ACGTTGGATGGGACACAGAACATCATTCTC

 

99

CTTAGCATAATGTGGAGATGATGA

7455.9

rs5912619

ACGTTGGATGTTAGTTCTGCTCTCATGTTG

 

ACGTTGGATGACAAGAACAAGCCAAACCC

 

85

CTCTCATGTTGATTATTACTTTTCTT

7858.1

rs1468160

ACGTTGGATGCTAAAATCTCCATGATTCAG

 

ACGTTGGATGGCAATCTACAAGTTTTGGTC

 

96

ATATTATTGTTATGATCTCCTTTTTA

7906.2

rs17280621

ACGTTGGATGTGAGCAGTCAGATGGAGTTG

 

ACGTTGGATGAGAAGGGACCTGCTATAGTG

 

89

GAGCAGTCAGATGGAGTTGAGATTCC

8075.3

Reaction â…¢ (17-plex)

rs7060326

ACGTTGGATGGACTGCCATGTCTTATTTCC

 

ACGTTGGATGTAAATCAGTGCCTTCCCTGC

 

90

TTCCTTGGCACCTCACA

5081.3

rs2808742

ACGTTGGATGGGGAAGTAATGGGTCATAAG

 

ACGTTGGATGCCCTCTTATAGTCTTAAGTC

 

102

AATGGAGCACTGGTAGT

5274.4

rs5920670

ACGTTGGATGTGAAGAATTCTTGGGTCTGC

 

ACGTTGGATGAGGAAATAAGAGTACGCTCC

 

89

CTCCCAGCCAGGTCAGCC

5405.5

rs4826623

ACGTTGGATGCAGCTTCTACTTCACTAGCC

 

ACGTTGGATGGAAAAACAGCTCATTTTGG

 

92

GAAAGTCCTGAGTGCTCTA

5827.8

rs594031

ACGTTGGATGTCTTCTCAAGGTCTCAGAGC

 

ACGTTGGATGACATGGGCTTAGATATGAGG

 

94

AGAGCTAATAAGTGACTGC

5860.8

rs6631828

ACGTTGGATGGTTGAAATGGTAGTGTTCAG

 

ACGTTGGATGTTTCAGACCATGCATCTAGG

 

90

AGTGTTCAGTTACAAGAAACC

6438.2

rs6646036

ACGTTGGATGCATAAATCAGCTTCCATATC

 

ACGTTGGATGGATGTGAGCTAAGGGTAAGG

 

95

CTTCCATATCTTGATCACTAAA

6628.3

rs3924423

ACGTTGGATGGTGAGTTTTTAGTGGCTCCC

 

ACGTTGGATGCCTTCCATCTTCTCTAGGTC

 

87

CTCCCGACAGAGCAATTTATGG

6719.4

rs6611148

ACGTTGGATGGGATCTATATACTAAAAACC

 

ACGTTGGATGCTATCTCCTTTGATTTCTTTC

 

98

TATACTAAAAACCAGAAAACAGA

7050.7

rs6633608

ACGTTGGATGCAGCTAGTTCACCAAGTTGC

 

ACGTTGGATGAAATTTCACATCCTGGTGAG

 

96

TTGCATTCTTTCTATTCATTCCTT

7200.7

rs5964206

ACGTTGGATGTGGCAACAAGATTTCCTGTG

 

ACGTTGGATGAAAGAGCAGCAGTGCTGTAG

 

99

TGTGTAATTTTTTTTCAAATTGGA

7377.8

rs12849634

ACGTTGGATGTGAGACCTCAGGATGACAGT

 

ACGTTGGATGACAGCCTCATACTGCAAGTC

 

98

TGACAGTGAATACAACTGAAATGT

7408.9

rs973212

ACGTTGGATGTATTCTCTCTTAGGCACTGG

 

ACGTTGGATGCTTAGTCACATCAAAGGAGC

 

95

TCTCTCTTAGGCACTGGTATACAAC

7591.9

rs6620798

ACGTTGGATGGCCAGCATGAGAGACAGAGA

 

ACGTTGGATGCATGATAGAGTTCTCATAAG

 

99

CCAGCATGAGAGACAGAGAGTGATG

7789.1

rs5916781

ACGTTGGATGGAAAGAAAGGCATATTTCCTG

 

ACGTTGGATGACTTGAAGCTATGAACTGTG

 

93

ttcCCTGTTTTTATTTACACAAATGA

7885.2

rs12840669

ACGTTGGATGCTGTACACTTAAATTGGCAC

 

ACGTTGGATGCAAATGAACTTTATTGGAG

 

81

gACTTAAATTGGCACATTTTATTATA

7958.2

rs4276834

ACGTTGGATGCATTCAAAATGCTAACAGAGG

 

ACGTTGGATGCCACCCAAGGACAGCTATTC

 

97

ATGCTAACAGAGGAAAATATTTCTTA

8001.2

Reaction â…£ (17-plex)

rs5933388

ACGTTGGATGATCACCCCAAGAAGAAACCC

 

ACGTTGGATGGGAGGGGTTGGAAAAATATG

 

83

GAAGAAACCCAGGACCC

5182.4

rs6418330

ACGTTGGATGGTTTCATGCACTCTTTCCAC

 

ACGTTGGATGATGGGATCACTGAATACTTC

 

95

ACTCTTTCCACTAGCATC

5369.5

rs5927322

ACGTTGGATGTCAAAATATATCCTGGCAGC

 

ACGTTGGATGCTCTGGGAATGACCTAAATC

 

97

CCTGGCAGCAAAGATATA

5516.6

rs10855633

ACGTTGGATGTCTTTTAGATACATGGCCAG

 

ACGTTGGATGGCAATTTGGAGATTTCTCA

 

100

ATGGCCAGTAATAGGATC

5547.6

rs5986751

ACGTTGGATGATCTGCCAAGACTTCACTGC

 

ACGTTGGATGCAGAAAGCCTGTTGTGATCC

 

100

TTTTGCTTCCCTCACAGTG

5720.7

rs2519557

ACGTTGGATGTGACAACTATAAGACCCATC

 

ACGTTGGATGTGGCTGATTTCGCTGACTTG

 

99

GACCCATCTATTAGAGAGCC

6086

rs6527549

ACGTTGGATGGAGAAATACAGGTGTTTCGTG

 

ACGTTGGATGCCTGCCTAACTGTCTGTAAA

 

100

ggGGTGTTTCGTGTGTTGAC

6226

rs6649211

ACGTTGGATGGAGTTAAAAATTCTCCCATCC

 

ACGTTGGATGCTGTGACAGTTGGTAAGGTG

 

84

ttgATTCTCCCATCCACAATA

6300.1

rs5928614

ACGTTGGATGTTTGTGTCGTCTCTGTTGTG

 

ACGTTGGATGTGAAGGAGAAAATGTAATG

 

96

TTGTGTAAACTCTTTAGACAA

6419.2

rs183277

ACGTTGGATGGAAGGAACGTCAGTGGTCAG

 

ACGTTGGATGCTGCCACCTATATGATCCAG

 

102

AACGTCAGTGGTCAGCTTTGT

6452.2

rs7880460

ACGTTGGATGCCACATCCTTGTCAACACAC

 

ACGTTGGATGAGTTCATAGCCACTTGGTTG

 

83

TCAACACACATTATTATCTTTTT

6922.5

rs5955927

ACGTTGGATGGCACAGCGCCTGATATAAAG

 

ACGTTGGATGGCTTAAATATGTATCTCTTCC

 

99

AGTAGTTTCTCAATAGCATTTTG

7043.6

rs5908324

ACGTTGGATGTTAATGGGCTGAAACAGAAC

 

ACGTTGGATGTTTTAAGCCTCTTTTTAAAC

 

98

GAAACAGAACAAATTTTATTTCAC

7327.8

rs5906919

ACGTTGGATGGCTCTACTCACGTGCCTTTT

 

ACGTTGGATGCATTTCGGTTAGAGTTTAGTC

 

97

CCTTTTATAAAGTTTAGGTCTGAAC

7646

rs5980274

ACGTTGGATGGTGAATCTGAATGTTCTGC

 

ACGTTGGATGTGGTATTGCTCGTACATGG

 

100

CTTTATGTATCAATGTTCCTATCATA

7885.2

rs5926442

ACGTTGGATGGACTTTCTTGCTAAAAAGTT

 

ACGTTGGATGCTGTAAAAACAAAATTTCTC

 

100

cacCTTTCTTGCTAAAAAGTTTATCAC

8168.3

rs5956616

ACGTTGGATGCTCAAATTCTATTTGTAAGC

 

ACGTTGGATGTGGATTTTAGGCTTCCTGAC

 

82

ccCTATTTGTAAGCATATACTCAATAC

8177.3

 

SNP Typing

SNP genotyping was performed using the MassARRAY MALDI-TOF MS platform (Sequenom Inc.). Briefly, three 17-plex and one 16-plex amplification reactions were processed following standard protocols for iPLEX chemistry. The reaction products were used as templates for the primer extension reactions. All reactions were performed in 384 microtiter plates (Sequenom, Inc.). PCR amplification and primer extension reaction were carried out on a GeneAmp PCR System 9700 (Applied Biosystems, Norwalk, CT), and no-template controls were carried along in every plate to exclude contaminations. A panel of genomic DNA samples genotyped by the assay was sequenced simultaneously for quality control.

Multiplex PCR

SNP genotyping was performed using the MassARRAY MALDI-TOF MS platform (Sequenom Inc.). PCRs (final volume, 5 μL) contained 1μL the desired primers at their optimized concentrations, 0.625μL PCR buffer(10×) (Qiagen GmbH), 0.325μL 25 mmol/L MgCl2, 1μL dNTP (2.5mmol/L) (Tatara Inc.), 0.1μL of HotStarTaq polymerase (5U/μL), 1μL of DNA , and 0.95μL H2O. A tag (5’-ACGTTGGATG) was included in the primer sequence. PCR conditions were 94 °C for 15 min followed by 45 cycles at 94 °C for 20 s, 56 °C for 30 s, and 72 °C for 1 min; and finally 72 °C for 3 min.

SAP Dephosphorylation

After amplification, the products of four reactions (i.e. 17-plex, 16-plex, 17-plex and 17-plex) were treated with shrimp alkaline phosphatase (SAP) to remove excess dNTPs. This reaction contained 0.17μL SAP buffer (10×), 0.3μL SAP (1U/μL), 1.53μL H2O (all from Sequenom Inc.). The reaction conditions were 37 °C for 40 min, followed by 85 °C for 15 min.

Primer Extension Reactions

The PCR products were then used as templates for the primer extension reactions. This reaction (final volume was 9μL) contained 0.94μL extension primers at optimized concentrations,0.1μL iPlex termination mix, 0.2μL iPlex buffer (10×), 0.0205μL iPlex enzyme and 0.7395μL H2O (all from Sequenom Inc). Extension reactions were performed at 94 °C for 30 s followed by 40 cycles at 94 °C for 5 s and 5 cycles of 52 °C for 5 s, 80 °C for 5 s; and finally 72 °C for 3 min. The extension products were treated with a cationic exchange resin (AG® 50W-X8 Resin; Bio-Rad Laboratories, Inc.) for 30 min to remove salts.

MALDI-TOF MS

The products were spotted onto the MassARRAY SpectroCHIP with an auto-spot arm (Sequenom, Inc.) and then the target plate was inserted into the MALDI-TOF mass spectrometer of MassARRAY compact System (Sequenom, Inc.). The mass range of the MS instrument was set at 3920—12023 Da. SNP loci was genotyped by MassArray Typer Analyzer software version 4.0 (Sequenom, Inc.).

Statistical Analysis

Tests of Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were performed using the Power marker v3.25 program. The formula for calculation of expected heterozygosity (H) and polymorphism information contents (PIC) were introduced by Nei and Roychoudhury (1974) The formula for calculation of discrimination power and exclusion probability were published by Szibor et al (2003).

Results and Discussion

Validation

The procedure to type SNPs used in this study was convenient with multiplexes where 67 X-SNP markers were amplified in four reactions. Validating carried out on control DNA 9947A and DNA extracts prepared from blood samples with known X-SNP profiles from MALDI-TOF MS assay by sequencing revealed fully consistent and reproducible results.

The MALDI-TOF MS technique requires the initial concentration of DNA is not less than 50ng/µL. If the amount of DNA is limited, it may be necessary to use other platform such as SNaPshot (Bouakaze et al 2007 and Wei et al 2012) or to perform a whole genome amplification of the sample previously.

Testing of Linkage Disequilibrium and Calculation for ‘Forensic Statistics’

Population data of 67 X-SNPs were obtained. The exact test of 67 X-SNPs showed no deviation from Hardy-Weinberg equilibrium (p>0.05) except for rs12849634 (p=0.0007).

Two out of the other 66 X-SNP loci (i.e.rs1229078, rs1544545) were found to be low informative (MAF<0.3).Tight LD were observed at six groups (rs5986750- rs5986751, rs183277 - rs7060326, rs6611148 - rs4826623, rs5923750 - rs1166756, rs6620798 - rs5917032, rs2519557 - rs6649211)and slight LD were found at two groups (rs4276834 - rs5928614;rs5968332 - rs6418330). 52 X-SNP loci showing independent inheritance and high polymorphisms were finally selected out (Table 2). Based on the population data (Table 2), the combined values of Discrimination Power in female population and male populations are as follows: CDPf=0.9999999999999999999 and CDPm=0.99999999999999931. The combined values of Exclusion Probabilities in trio cases and duo case were are as follows: CPEtrios=0.99999999996 and CPEduos=0.9999995. The results revealed that the SNP panel on X chromosome yield the equivalent power in forensic identification as 15 STR markers currently used.

Table 2: Forensic efficiency of 52 X-SNPs

No

X-SNP

allele

frequency

H

PIC

DPfemale

DPmale

PEtrios

PEduos

1

rs6639398

A/G

0.50/0.50

0.5017

0.3750

0.6250

0.5000

0.3750

0.2500

2

rs6631828

C/T

0.50/0.50

0.5017

0.3750

0.6250

0.5000

0.3750

0.2500

3

rs5917032

C/G

0.50/0.50

0.5017

0.3750

0.6250

0.5000

0.3750

0.2500

4

rs5912619

A/G

0.51/0.49

0.5016

0.3750

0.6250

0.4999

0.3750

0.2500

5

rs2070289

A/G

0.49/0.51

0.5016

0.3750

0.6250

0.4999

0.3750

0.2500

6

rs3924423

C/T

0.51/0.49

0.5015

0.3749

0.6249

0.4998

0.3749

0.2499

7

rs9781645

C/T

0.51/0.49

0.5014

0.3748

0.6248

0.4997

0.3748

0.2498

8

rs183277

G/A

0.51/0.49

0.5013

0.3748

0.6248

0.4996

0.3748

0.2498

9

rs2209420

A/C

0.51/0.49

0.5013

0.3748

0.6248

0.4996

0.3748

0.2498

10

rs5933388

C/T

0.51/0.49

0.5013

0.3748

0.6248

0.4996

0.3748

0.2498

11

rs5908324

A/G

0.48/0.52

0.5010

0.3746

0.6246

0.4993

0.3746

0.2496

12

rs5980274

C/T

0.52/0.48

0.5004

0.3744

0.6244

0.4987

0.3744

0.2494

13

rs6639989

G/T

0.53/0.47

0.4998

0.3741

0.6240

0.4981

0.3741

0.2490

14

rs5954988

C/T

0.54/0.46

0.4990

0.3737

0.6237

0.4973

0.3737

0.2487

15

rs1874111

A/T

0.46/0.54

0.4989

0.3734

0.6236

0.4972

0.3734

0.2486

16

rs2808742

A/G

0.54/0.464

0.4987

0.3735

0.6235

0.4970

0.3735

0.2485

17

rs5931302

C/G

0.54/0.46

0.4983

0.3733

0.6233

0.4966

0.3733

0.2483

18

rs6611148

G/T

0.46/0.54

0.4982

0.3731

0.6231

0.4963

0.3731

0.2481

19

rs5986750

A/G

0.55/0.45

0.4973

0.3728

0.6228

0.4956

0.3728

0.2478

20

rs5964206

C/G

0.45/0.55

0.4957

0.3718

0.6220

0.4940

0.3718

0.2470

21

rs6646036

C/T

0.45/0.55

0.4957

0.3718

0.6220

0.4940

0.3718

0.2470

22

rs7876774

C/T

0.56/0.44

0.4950

0.3717

0.6216

0.4934

0.3717

0.2467

23

rs2694717

A/C

0.44/0.56

0.4945

0.3714

0.6213

0.4928

0.3714

0.2464

24

rs5920670

A/G

0.44/0.56

0.4945

0.3714

0.6213

0.4928

0.3714

0.2464

25

rs594031

C/T

0.44/0.56

0.4938

0.3710

0.6210

0.4921

0.3710

0.2461

26

rs5906919

A/G

0.57/0.43

0.4931

0.3708

0.6206

0.4915

0.3708

0.2457

27

rs471205

A/G

0.43/0.57

0.4931

0.3708

0.6206

0.4915

0.3708

0.2457

28

rs7471388

C/G

0.43/0.57

0.4931

0.3707

0.6206

0.4915

0.3707

0.2457

29

rs5928614

A/G

0.57/0.43

0.4926

0.3702

0.6203

0.4909

0.3702

0.2454

30

rs1166756

C/G

0.43/0.57

0.4924

0.3703

0.6202

0.4908

0.3703

0.2454

31

rs5926442

C/T

0.43/0.57

0.4907

0.3694

0.6193

0.4889

0.3694

0.2445

32

rs2214174

A/G

0.42/0.58

0.4902

0.3692

0.6191

0.4885

0.3692

0.2443

33

rs6418330

A/G

0.42/0.58

0.4901

0.3692

0.6190

0.4884

0.3692

0.2442

34

rs149860

C/G

0.58/0.42

0.4901

0.3692

0.6190

0.4884

0.3692

0.2442

35

rs5905043

C/T

0.42/0.58

0.4901

0.3693

0.6190

0.4884

0.3693

0.2442

36

rs6649211

A/C

0.42/0.57

0.4900

0.3691

0.6190

0.4883

0.3691

0.2442

37

rs5989571

A/T

0.58/0.42

0.4887

0.3682

0.6182

0.4870

0.3682

0.2435

38

rs17280621

A/G

0.58/0.42

0.4887

0.3684

0.6182

0.4870

0.3684

0.2435

39

rs5956616

A/G

0.42/0.58

0.4875

0.3678

0.6176

0.4859

0.3678

0.2429

40

rs203648

A/G

0.58/0.42

0.4875

0.3678

0.6176

0.4859

0.3678

0.2429

41

rs2768595

A/T

0.58/0.42

0.4874

0.3678

0.6176

0.4857

0.3678

0.2429

42

rs6633608

A/T

0.40/0.60

0.4837

0.3661

0.6156

0.4821

0.3661

0.2410

43

rs1468160

A/G

0.60/0.40

0.4829

0.3655

0.6151

0.4813

0.3655

0.2406

44

rs5955927

C/T

0.60/0.40

0.4827

0.3653

0.6150

0.4811

0.3653

0.2405

45

rs7880460

G/T

0.61/0.39

0.4792

0.3638

0.6130

0.4776

0.3638

0.2388

46

rs12840669

C/T

0.62/0.38

0.4752

0.3614

0.6107

0.4736

0.3614

0.2368

47

rs6418251

A/C

0.62/0.38

0.4734

0.3605

0.6097

0.4718

0.3605

0.2359

48

rs973212

C/T

0.62/0.38

0.4718

0.3597

0.6088

0.4702

0.3597

0.2351

49

rs5916781

A/G

0.62/0.38

0.4710

0.3592

0.6083

0.4694

0.3592

0.2347

50

rs5927322

A/G

0.64/0.36

0.4624

0.3549

0.6031

0.4608

0.3549

0.2304

51

rs5932595

G/T

0.34/0.66

0.4512

0.3486

0.5960

0.4496

0.3486

0.2248

52

rs17264553

G/T

0.34/0.66

0.4501

0.3480

0.5953

0.4486

0.3480

0.2243

 

Comparison of Population Genetic Data

Of the 67 X-SNP loci, 10 loci (i.e. rs1229078, rs1544545, rs4442270, rs1874111, rs5968332, rs1166756, rs12849634, rs5932595, rs203648 and rs611711) has been reported the power of discrimination and power of exclusion among Spanish population from coastal area and Pas valley by Zarrabeitia (2007). Analysis of pairwise genetic data between the Spanish population and the Chinese Han groups revealed strong similarities at seven X-SNP loci (i.e. rs4442270, rs1874111, rs5968332, rs1166756, rs5932595, rs203648 and rs611711), but highly significant differences at three X-SNP loci (i.e. rs1229078, rs1544545 and rs12849634). For example, the discrimination power of rs12849634 in Chinese Han female population and male populations were 0.0616 and 0.0316 respectively, but the values were as high as 0.6 and 0.5 respectively in the Spanish population. As for the other two loci, rs1229078 and rs1544545, their polymorphisms in the Spanish population were also higher than that in Chinese Han population.Therefore, it is necessary to investigate the polymorphisms in particular race in order to apply the X-SNP markers to the race.

The results in this study showed that the panel consisting of 52 X-SNP markers was high informative in Chinese Han population. It gives reasonable discrimination and paternity exclusion power that is sufficient for forensic identification.

Acknowledgements

This work was supported by grants from Shanghai Natural Science Foundation and National Institute Scientific Program (Nos.08ZR1419800 and GY0805).

References

1. Bouakaze, C., Keyser, C., Amory, S., Crubézy, E. & Ludes, B. (2007). “First Successful Assay of Y-SNP Typing by SNaPshot Minisequencing on Ancient DNA,” International Journal of Legal Medicine, 121(6) 493-499
PublisherGoogle Scholar

2. Nei, M. & Roychoudhury, A. K. (1974). “Sampling Variances of Heterozygosity and Genetic Distance,” Genetics, 76(2) 379-390.
PublisherGoogle Scholar

3. Pereira, V., Tomas, C., Amorim, A., Morling, N., Gusmão, L. & Prata, M. J. (2011). “Study of 25 X-chromosome SNPs in the Portuguese,” Forensic Science International Genetics, 5(4)336-338.
PublisherGoogle Scholar

4. Storm, N., Darnhofer-Patel, B., van den Boom, D. & Rodi, C. P. (2003). “MALDI-TOF Mass Spectrometry-Based SNP Genotyping,” Methods in Molecular Biology, (212)241-262.
PublisherGoogle Scholar

5. Szibor, R., Krawczak, M., Hering, S., Edelmann, J., Kuhlisch, E. & Krause, D. (2003). “Use of X-linked Markers for Forensic Purposes,” International Journal of Legal Medicine, 117(2) 67-74
PublisherGoogle Scholar

6. Tost, J. & Gut, I. G. (2005). “Genotyping Single Nucleotide Polymorphisms by MALDI Mass Spectrometry in Clinical Applications,” Clinical biochemistry, 38(4) 335-350.
PublisherGoogle Scholar

7. Wei, W., Luo, H. B., Yan, J. & Hou, Y. P. (2012). “Exploring of New Y-chromosome SNP Loci Using Pyrosequencing and the SNaPshot Methods,” International Journal of Legal Medicine, 126(6):825-833
PublisherGoogle Scholar

8. Zarrabeitia, M. T., Mijares, V. & Riancho, J. A. (2007). “Forensic Efficiency of Microsatellites and Single Nucleotide Polymorphisms on the X Chromosome,” International Journal of Legal Medicine, 121(6) 433- 437.
PublisherGoogle Scholar